| Primary Identifier | MGI:5578182 | Allele Type | Targeted |
| Attribute String | Conditional ready, Reporter | Gene | Gt(ROSA)26Sor |
| Transmission | Germline | Strain of Origin | 129 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | The targeting vector contains (from 5' to 3') a CAG promoter, a mutant loxP63(ATAACTTCGTATAGCCTACATTATACGAAGTTAT)-triple poly A/stop-wild type loxP (ATAACTTCGTATAGCATACATTATACGAAGTTAT), a nuclear-localized tdTomato with a C-terminal triple hemaglutinin (HA) epitope, an bovine growth hormone 3' UTR, and a Frt-PGKneo-Frt cassette. The stop cassette consists of three tandem SV40 polyadenylation/transcription termination sequences. |
