|  Help  |  About  |  Contact Us

Allele : Iqcj<em1(IMPC)J> IQ motif containing J; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5585265 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Iqcj
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Iqcj-5923J-4293 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence CCTTTAGAACAAGTTGACGA, which resulted in an 11 bp deletion AACAAGTTGAC in exon 2 beginning at Chromosome 3 positive strand position 68041225 bp (GRCm38) and a 6 bp insertion TAAATG. This mutation is predicted to cause amino acid sequence changes after residue 13 and an early truncation 8 amino acids later.
  • mutations:
  • Intragenic deletion,
  • Insertion
  • synonyms:
  • Iqcj<em1J>,
  • Iqcj<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories