| Primary Identifier | MGI:5585265 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Iqcj |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Iqcj-5923J-4293 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence CCTTTAGAACAAGTTGACGA, which resulted in an 11 bp deletion AACAAGTTGAC in exon 2 beginning at Chromosome 3 positive strand position 68041225 bp (GRCm38) and a 6 bp insertion TAAATG. This mutation is predicted to cause amino acid sequence changes after residue 13 and an early truncation 8 amino acids later. |