|  Help  |  About  |  Contact Us

Allele : Zfyve26<em1(IMPC)J> zinc finger, FYVE domain containing 26; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5585269 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfyve26
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Zfyve26-5939J-1816 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GGAGGACATACTACAGGCGC, which resulted in an 11 bp deletion ATACTACAGGC in exon 2 beginning at Chromosome 12 negative strand position 79295514 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 52 and an early truncation 57 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Zfyve26<em1J>,
  • Zfyve26<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories