|  Help  |  About  |  Contact Us

Allele : Plk5<em1(IMPC)J> polo like kinase 5; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5585597 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Plk5
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Plk5-5922J-4194 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence CGAGCCTGGGTCGCGCAGGA, which resulted in a 1 bp deletion G in exon 1 beginning at Chromosome 10 positive strand position 80356646 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 28 and an early truncation 3 amino acids later.
  • mutations:
  • Single point mutation,
  • Intragenic deletion
  • synonyms:
  • Plk5<em1J>,
  • Plk5<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

3 Publication categories