| Help | About | Contact Us

Allele : Adad2<em3(IMPC)J> adenosine deaminase domain containing 2; endonuclease-mediated mutation 3, Jackson

Primary Identifier	MGI:5604765	Allele Type	Endonuclease-mediated
Attribute String	Not Specified	Gene	Adad2
Strain of Origin	C57BL/6NJ	Is Recombinase	false
Is Wild Type	false	Project Collection	IMPC

molecularNote

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence CCCATGCTCAGCGGTCCTAG which resulted in this single base pair (G) deletion at Chr 8 position 119,612,906 bp

mutations:
Insertion,
Intragenic deletion

synonyms:
Adad2<em3>,
Adad2<em3>

earliestPublication:
Snyder E, et al. (2020) ADAD1 and ADAD2, testis-specific adenosine deaminase domain-containing proteins, are required for male fertility. Sci Rep 10(1):11536

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

Other

0 Carried By

0 Driven By

4 Publication categories

Questions? Comments? Click here!

MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Your name:
Your email address:
Subject:
Message:	---- Current page: ---- /mousemine/report.do?id=76525945

MouseMine