|  Help  |  About  |  Contact Us

Allele : Adad2<em3(IMPC)J> adenosine deaminase domain containing 2; endonuclease-mediated mutation 3, Jackson

Primary Identifier  MGI:5604765 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Adad2
Strain of Origin  C57BL/6NJ Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence CCCATGCTCAGCGGTCCTAG which resulted in this single base pair (G) deletion at Chr 8 position 119,612,906 bp
  • mutations:
  • Insertion,
  • Intragenic deletion
  • synonyms:
  • Adad2<em3>,
  • Adad2<em3>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

4 Publication categories