|  Help  |  About  |  Contact Us

Allele : Rr251<tm2.1Ebres> regulatory region 251; targeted mutation 2.1, Emery H Bresnick
Primary Identifier  MGI:5605695 Allele Type  Targeted
Attribute String  Modified regulatory region, No functional change Gene  Rr251
Transmission  Germline Strain of Origin  Not Specified
Is Recombinase  false Is Wild Type  false
molecularNote  The 27 nucleotide -3.9 site (AGATAGGAAAATGGCCGCGCGCTATCT) containing inverted WGATAR motifs was replaced with a loxP site flanked neomycin resistance gene cassette. The neo cassette was removed through subsequent cre-mediated recombination. Expression levels of Gata2 mRNA in Lin- progenitors, Ter119+ erythroid cells and the fetal liver and brain are indistinguishable from that in wild-type mice.
  • mutations:
  • Insertion,
  • Intragenic deletion
  • synonyms:
  • -3.9<->,
  • Gata2<tm2.1Ebres>,
  • Gata2<tm2.1Ebres>,
  • -3.9<->
Paste the following link
Quick Links:
SummaryGenomePhenotypeOther
 
Quick Links:
SummaryGenomePhenotypeOther
 
Lists
This Allele isn't in any lists. Upload a list.

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

4 Publication categories





MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Copyright © 2017 by The Jackson Laboratory. All Rights Reserved

© 2002 - 2017 Department of Genetics, University of Cambridge, Downing Street,
Cambridge CB2 3EH, United Kingdom