|  Help  |  About  |  Contact Us

Allele : Stk36<em1(IMPC)J> serine/threonine kinase 36; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5605978 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Stk36
Strain of Origin  C57BL/6NJ Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project Stk36-5876J-2652 was generated at The Jackson Laboratory by injecting Cas9 D10 nickase RNA and guide sequences CGAGAGATTGAAATCATGCG and TTTCTCTGAGCGCCCCAGTT, which resulted in an 8 bp deletion (AAATCATG) in exon 3 beginning at Chromosome 1 positive strand position 74603211bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 52 and early truncation 15 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Stk36<em1J>,
  • Stk36<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories