| Primary Identifier | MGI:5605978 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Stk36 |
| Strain of Origin | C57BL/6NJ | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project Stk36-5876J-2652 was generated at The Jackson Laboratory by injecting Cas9 D10 nickase RNA and guide sequences CGAGAGATTGAAATCATGCG and TTTCTCTGAGCGCCCCAGTT, which resulted in an 8 bp deletion (AAATCATG) in exon 3 beginning at Chromosome 1 positive strand position 74603211bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 52 and early truncation 15 amino acids later. |
