| Primary Identifier | MGI:5607863 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ncoa6 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Ncoa6-6076J-P6MB was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence ATCTACAATGGGCGACTCAG, which resulted in an 11 bp deletion GGCGACTCAGA in exon2 beginning at Chromosome 2 negative strand position 155,437,978 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 22 and early truncation 2 amino acids later. |
