|  Help  |  About  |  Contact Us

Allele : Ncoa6<em1(IMPC)J> nuclear receptor coactivator 6; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5607863 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ncoa6
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Ncoa6-6076J-P6MB was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence ATCTACAATGGGCGACTCAG, which resulted in an 11 bp deletion GGCGACTCAGA in exon2 beginning at Chromosome 2 negative strand position 155,437,978 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 22 and early truncation 2 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Ncoa6<em1J>,
  • Ncoa6<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele