|  Help  |  About  |  Contact Us

Allele : Matr3<em1Lmjn> matrin 3; endonuclease-mediated mutation 1, Lauryl Nutter

Primary Identifier  MGI:7606214 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready, No functional change Gene  Matr3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  his allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with a guide RNAs with the spacer sequences TGCTCTGATATCTAATATTG and GAACCACGAGAGTTGGTCAT. A single repair template containing the loxP sites, intervening sequence and flanking homology arms was delivered by incubating embryos with recombinant AAV. This resulting allele has loxP sites flanking exons ENSMUSE00000337447, ENSMUSE00000360581, and ENSMUSE00000341974 (GRCm39). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele.
  • mutations:
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories