| Primary Identifier | MGI:5616624 | Allele Type | Endonuclease-mediated |
| Attribute String | Hypomorph | Gene | Smg9 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Smg9-6001-MP6R was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence TCTACGGGATAGAGCGGCGG, which resulted in a 2 bp deletion GG and a 10 bp insertion CTGGGTTCTA in exon 2 beginning at Chromosome 7 positive strand approximate position 24,403,446 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 15 and early truncation 88 amino acids later. QRT-PCR confirmed a severe reduction in transcript expression. |