|  Help  |  About  |  Contact Us

Allele : Smg9<em1(IMPC)J> SMG9 nonsense mediated mRNA decay factor; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5616624 Allele Type  Endonuclease-mediated
Attribute String  Hypomorph Gene  Smg9
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Smg9-6001-MP6R was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence TCTACGGGATAGAGCGGCGG, which resulted in a 2 bp deletion GG and a 10 bp insertion CTGGGTTCTA in exon 2 beginning at Chromosome 7 positive strand approximate position 24,403,446 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 15 and early truncation 88 amino acids later. QRT-PCR confirmed a severe reduction in transcript expression.
  • mutations:
  • Intragenic deletion,
  • Insertion
  • synonyms:
  • Smg9<em1J>,
  • Smg9<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

6 Publication categories