| Primary Identifier | MGI:5616626 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Prss56 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Prss56-6052-104P4MB was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GCCCCAGGTCACCATGCCGC, which resulted in a 1 bp insertion (G) after exon1 beginning at Chromosome 1 positive strand position 87183497 bp (GRCm38), which is after the sequence GGTCACCATGC. This mutation is predicted to cause amino acid sequence changes after residue 2 and early truncation 66 amino acids later. |
