|  Help  |  About  |  Contact Us

Allele : Prss56<em1(IMPC)J> serine protease 56; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5616626 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Prss56
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Prss56-6052-104P4MB was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GCCCCAGGTCACCATGCCGC, which resulted in a 1 bp insertion (G) after exon1 beginning at Chromosome 1 positive strand position 87183497 bp (GRCm38), which is after the sequence GGTCACCATGC. This mutation is predicted to cause amino acid sequence changes after residue 2 and early truncation 66 amino acids later.
  • mutations:
  • Insertion
  • synonyms:
  • Prss56<em1J>,
  • Prss56<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele