| Primary Identifier | MGI:5620147 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Poc1a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Poc1a-5675J-3728 was generated at The Jackson Laboratory by injecting Cas9 nickase RNA and guide sequences GGCAAGAAGGTGTCCCGATG and GAGACAAGACTGTTCGCATC, which resulted in a 30 bp deletion CTCCCCATCGGGACACCTTCTTGCCTCAGG in exon3 beginning at Chromosome 9 positive strand position 106,284,984 - 106,285,013 bp (GRCm38). This mutation is predicted to cause a 10 amino acid in-frame deletion after residue 70. |
