| Primary Identifier | MGI:5620177 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nxn |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Nxn-6439J-FP22R was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequences GCGTCTAGGAATATTAGCGA, ACTCTGCAATTAATTTGGTT and TGACCCGGAAGGTAAGGCTT which resulted in a 5 bp deletion ATCGC in exon 2 beginning at Chromosome 11 negative strand position 76278553bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 133 and early truncation 21 amino acids later. |
