|  Help  |  About  |  Contact Us

Allele : Serpina7<em1(IMPC)J> serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5620681 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Serpina7
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Serpina7-6133J-FP4L was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequences GTCATTTGCCCCAACAAAAT and ATACAGACTGAATGCAAAGT which resulted in a 7 bp deletion ATTTGCC in exon2 beginning at Chromosome X negative strand position 139,083,601 - 139,083,595 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 41 and early truncation 31 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Serpina7<em1J>,
  • Serpina7<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

3 Publication categories