| Primary Identifier | MGI:5620681 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Serpina7 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Serpina7-6133J-FP4L was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequences GTCATTTGCCCCAACAAAAT and ATACAGACTGAATGCAAAGT which resulted in a 7 bp deletion ATTTGCC in exon2 beginning at Chromosome X negative strand position 139,083,601 - 139,083,595 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 41 and early truncation 31 amino acids later. |
