|  Help  |  About  |  Contact Us

Allele : Pigc<em1(IMPC)J> phosphatidylinositol glycan anchor biosynthesis, class C; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5629300 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Pigc
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Pigc-6237J-103MR was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequences TGTAGTGATCTGGTGGTACA and CCCCAGTGGCTTTTTGGGAC, which resulted in a 1 bp deletion, T, in exon1 at Chromosome 1 positive strand position 161,970,654 bp (GRCm38) that is predicted to cause amino acid sequence changes after residue 67 and early truncation 1 amino acid later. There is an additional 11 bp deletion, tggctccccag, 34 bp after the 1 bp deletion, in exon 1 beginning at Chromosome 1 positive strand position 161,970,689.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Pigc<em1J>,
  • Pigc<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories