| Primary Identifier | MGI:5629300 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pigc |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Pigc-6237J-103MR was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequences TGTAGTGATCTGGTGGTACA and CCCCAGTGGCTTTTTGGGAC, which resulted in a 1 bp deletion, T, in exon1 at Chromosome 1 positive strand position 161,970,654 bp (GRCm38) that is predicted to cause amino acid sequence changes after residue 67 and early truncation 1 amino acid later. There is an additional 11 bp deletion, tggctccccag, 34 bp after the 1 bp deletion, in exon 1 beginning at Chromosome 1 positive strand position 161,970,689. |
