|  Help  |  About  |  Contact Us

Allele : Myom1<em1(IMPC)J> myomesin 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5629301 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Myom1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Myom1-6238J-102P4ML was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence TCGTGCGAAGGTCCTTGTTC, which resulted in a 37 bp deletion CCATCAGCACTATGATCTCAGTTACCGGAACAAGGAC in exon2 beginning at chromosome 17 positive strand position 71022901-71022937 bp (GRCm38) that is predicted to cause amino acid sequence changes after residue 9 and early truncation 4 amino acid residues later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Myom1<em1J>,
  • Myom1<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

3 Publication categories