| Primary Identifier | MGI:5629301 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Myom1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Myom1-6238J-102P4ML was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence TCGTGCGAAGGTCCTTGTTC, which resulted in a 37 bp deletion CCATCAGCACTATGATCTCAGTTACCGGAACAAGGAC in exon2 beginning at chromosome 17 positive strand position 71022901-71022937 bp (GRCm38) that is predicted to cause amino acid sequence changes after residue 9 and early truncation 4 amino acid residues later. |
