|  Help  |  About  |  Contact Us

Allele : Med20<em1(IMPC)J> mediator complex subunit 20; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5643678 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Med20
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Med20-6705J-M5886 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, AGGAACTCTTGGGGACTGAT and GCTTAGAGTATTTACGTTAA (along with a plasmid containing 1 kb homology arms flanking the floxed critical exon, which did not integrate) which resulted in a 348bp deletion beginning in intron 1 at GGGGACTGATGGGTGGGGAT at Chromosome 17 positive strand position 47,612,827 bp (GRCm38) and ending after GCTTAGAGTATTTACGTTAAT at position 47,613,174 bp in intron 2. This mutation deletes exon 2 and is predicted to cause amino acid sequence changes after residue 4 and early truncation 11 amino acids later. PCR failed to detect the insertion of any loxP sites. RT-PCR analysis confirmed the absence of mRNA expression in homozygous mutant blastocysts.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Med20<em1J>,
  • Med20<->,
  • Med20<->,
  • Med20<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

7 Publication categories

Trail: Allele