|  Help  |  About  |  Contact Us

Allele : Ap4e1<em1(IMPC)J> adaptor-related protein complex AP-4, epsilon 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5638898 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ap4e1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Ap4e1-6638-2877F was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, GCAATCAAGTTGGCCCAACA, TGTCCTGACTGTCGTTTTTA and CTGTTTGTTTACATAGTGAT which resulted in a 1bp insertion A in exon 3 beginning at Chromosome 2 positive strand position 127,014,235 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 105 and early truncation 19 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Ap4e1<em1J>,
  • Ap4e1<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories