|  Help  |  About  |  Contact Us

Allele : Prkab1<em1(IMPC)J> protein kinase, AMP-activated, beta 1 non-catalytic subunit; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5642073 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Prkab1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Prkab1-6663J-9043 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences: CCTGTCCATCGAAACACGGT, AGAGGCGTTTACTTGGGGTCAGG, and CCGAGATCCTTACCTTCTCG, which resulted in a 208 bp deletion in exon 2 beginning at Chromosome 5 negative strand position 116,021,672 bp at CCCAAGTAAACGCCTCTGCTT and ending after AGGTAAGGATCTCGGCGGAC at 116,021,465 bp (GRCm38). This mutation deletes exon2 and is predicted to cause amino acid sequence changes after residue 53 and early truncation 2 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Prkab1<em1J>,
  • Prkab1<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories