| Primary Identifier | MGI:5642073 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Prkab1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Prkab1-6663J-9043 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences: CCTGTCCATCGAAACACGGT, AGAGGCGTTTACTTGGGGTCAGG, and CCGAGATCCTTACCTTCTCG, which resulted in a 208 bp deletion in exon 2 beginning at Chromosome 5 negative strand position 116,021,672 bp at CCCAAGTAAACGCCTCTGCTT and ending after AGGTAAGGATCTCGGCGGAC at 116,021,465 bp (GRCm38). This mutation deletes exon2 and is predicted to cause amino acid sequence changes after residue 53 and early truncation 2 amino acids later. |
