|  Help  |  About  |  Contact Us

Allele : Oard1<em1(IMPC)J> O-acyl-ADP-ribose deacylase 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5644469 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Oard1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Oard1-6555J-F6345 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, CCAAAACAGACTCTCTAGCCCAT and ATCAGTGAGGATTGTCGAAT, which resulted in a 287 bp deletion beginning in intron 3 at Chromosome 17 positive strand position 48,411,029 bp, CTGATTTACTTAGAAAAGGC, and ending after GTCCCAAAACAGACTCTCTAG in exon 3 at 48,411,315 bp (GRCm38/mm10). This mutation deletes part of exon 3 and the splice acceptor and is predicted to cause the complete loss of exon 3 resulting in amino acid sequence changes after 13 residues and early truncation 9 amino acid residues later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Oard1<em1J>,
  • Oard1<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

3 Publication categories