| Primary Identifier | MGI:5644469 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Oard1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Oard1-6555J-F6345 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, CCAAAACAGACTCTCTAGCCCAT and ATCAGTGAGGATTGTCGAAT, which resulted in a 287 bp deletion beginning in intron 3 at Chromosome 17 positive strand position 48,411,029 bp, CTGATTTACTTAGAAAAGGC, and ending after GTCCCAAAACAGACTCTCTAG in exon 3 at 48,411,315 bp (GRCm38/mm10). This mutation deletes part of exon 3 and the splice acceptor and is predicted to cause the complete loss of exon 3 resulting in amino acid sequence changes after 13 residues and early truncation 9 amino acid residues later. |
