|  Help  |  About  |  Contact Us

Allele : Dock6<em1(IMPC)J> dedicator of cytokinesis 6; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5639331 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dock6
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Dock6-6207J-FP2B was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence TGGTGACAGTTAACGTGGCC, which resulted in a 145 bp deletion and a T insertion in exon12 beginning at Chromosome 9 negative strand position 21,839,387 bp, CGGCCACGTTAACTGTCACCA, and ending after TACCTTGGGGAATCTGTATC at 21,839,244 bp (GRCm38/mm10). This mutation deletes the last 34 bp of coding sequence in exon 12, 111 bp in intron 13 as well as the splice donor and is predicted to result in a read through into exon 13 causing amino acid sequence changes after residue 448 and early truncation 26 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Dock6<em1J>,
  • Dock6<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories