| Primary Identifier | MGI:5639331 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dock6 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Dock6-6207J-FP2B was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence TGGTGACAGTTAACGTGGCC, which resulted in a 145 bp deletion and a T insertion in exon12 beginning at Chromosome 9 negative strand position 21,839,387 bp, CGGCCACGTTAACTGTCACCA, and ending after TACCTTGGGGAATCTGTATC at 21,839,244 bp (GRCm38/mm10). This mutation deletes the last 34 bp of coding sequence in exon 12, 111 bp in intron 13 as well as the splice donor and is predicted to result in a read through into exon 13 causing amino acid sequence changes after residue 448 and early truncation 26 amino acids later. |
