| Primary Identifier | MGI:5642374 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tmco1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Tmco1-6660J-M1122 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, ATAAGACGAAGTGAATATGT and CAACAATAGAGACCTGTCAA (along with a plasmid containing 1 kb homology arms flanking the floxed critical exon, which did not integrate) which resulted in a 281bp deletion beginning in intron 3 at TATTCACTTCGTCTTATTGA at Chromosome 1 positive strand position 167,316,119 bp (GRCm38) and ending after AGTTCTTAAAATGTATTACCT at position 167,316,399 bp in intron 4. This mutation deletes exon 4 and is predicted to cause amino acid sequence changes after residue 4 and early truncation 11 amino acids later. PCR failed to detect the insertion of any loxP sites. |
