| Primary Identifier | MGI:5644501 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified isoform(s) | Gene | Pcdhg |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Using CRISPR/Cas9 mediated mutation, a guide RNA (TAATACGACTCACTATAGAAGGCTCCAGCAGGTGGTAAGTTTAAGAGCTATGCTGGAAAC) was designed to create an early STOP codon (GGT to TAA) near the C-terminus of third protocadherin gamma cluster (Pcdhg) constant exon, resulting in a 15-amino acid C-terminal deletion in the constant domain of all 22 gamma-Pcdh protein isoforms. |
