|  Help  |  About  |  Contact Us

Allele : Pcdhg<em2Rwb> protocadherin gamma cluster; endonuclease-mediated mutation 2, Robert W Burgess

Primary Identifier  MGI:5644501 Allele Type  Endonuclease-mediated
Attribute String  Modified isoform(s) Gene  Pcdhg
Inheritance Mode  Not Specified Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  Using CRISPR/Cas9 mediated mutation, a guide RNA (TAATACGACTCACTATAGAAGGCTCCAGCAGGTGGTAAGTTTAAGAGCTATGCTGGAAAC) was designed to create an early STOP codon (GGT to TAA) near the C-terminus of third protocadherin gamma cluster (Pcdhg) constant exon, resulting in a 15-amino acid C-terminal deletion in the constant domain of all 22 gamma-Pcdh protein isoforms.
  • mutations:
  • Single point mutation
  • synonyms:
  • deltaC15,
  • deltaC15
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele