|  Help  |  About  |  Contact Us

Allele : Pcdhg<em2Rwb> protocadherin gamma cluster; endonuclease-mediated mutation 2, Robert W Burgess
Primary Identifier  MGI:5644501 Allele Type  Endonuclease-mediated
Attribute String  Modified isoform(s) Gene  Pcdhg
Inheritance Mode  Not Specified Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  Using CRISPR/Cas9 mediated mutation, a guide RNA (TAATACGACTCACTATAGAAGGCTCCAGCAGGTGGTAAGTTTAAGAGCTATGCTGGAAAC) was designed to create an early STOP codon (GGT to TAA) near the C-terminus of third protocadherin gamma cluster (Pcdhg) constant exon, resulting in a 15-amino acid C-terminal deletion in the constant domain of all 22 gamma-Pcdh protein isoforms.
  • mutations:
  • Single point mutation
  • synonyms:
  • deltaC15,
  • deltaC15
Paste the following link
Quick Links:
SummaryGenomePhenotypeOther
 
Quick Links:
SummaryGenomePhenotypeOther
 
Lists
This Allele isn't in any lists. Upload a list.

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele




MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Copyright © 2017 by The Jackson Laboratory. All Rights Reserved

© 2002 - 2017 Department of Genetics, University of Cambridge, Downing Street,
Cambridge CB2 3EH, United Kingdom