|  Help  |  About  |  Contact Us

Allele : Kcnd3<em1(IMPC)J> potassium voltage-gated channel, Shal-related family, member 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5644712 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Kcnd3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Kcnd3- 6780J-M7405 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, TGTTCGAGCAAGTGAGTGAT, TGGTGCCTAAGACAATCGCA and GCATGGACGTCCTCTCACT which resulted in a 327bp deletion beginning in intron 3 at GTTTCCCACATGGCCTCTTA at Chromosome 3 positive strand position 105,658,545 bp (GRCm38) and ending after TAAGTAAGAGGCCATGTGGGAAAC at position 105,658,871 bp in intron 4. This mutation deletes exon 3 and is predicted to cause amino acid sequence changes after residue 369 and early truncation 32 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Kcnd3<em1J>,
  • Kcnd3<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

6 Publication categories

Trail: Allele