| Primary Identifier | MGI:5644712 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Kcnd3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Kcnd3- 6780J-M7405 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, TGTTCGAGCAAGTGAGTGAT, TGGTGCCTAAGACAATCGCA and GCATGGACGTCCTCTCACT which resulted in a 327bp deletion beginning in intron 3 at GTTTCCCACATGGCCTCTTA at Chromosome 3 positive strand position 105,658,545 bp (GRCm38) and ending after TAAGTAAGAGGCCATGTGGGAAAC at position 105,658,871 bp in intron 4. This mutation deletes exon 3 and is predicted to cause amino acid sequence changes after residue 369 and early truncation 32 amino acids later. |
