|  Help  |  About  |  Contact Us

Allele : Olfml2b<em1(IMPC)J> olfactomedin-like 2B; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5644713 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Olfml2b
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Olfml2b-6834J-F3656 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, ATACAGTCGCACTTCCCAAG, AATCACCTACTATAAAGCCA and GGGATTTCATCCTTAGTGCA which resulted in a 390bp deletion beginning in intron 5 at GGCCCTCTTGGGAAGTGCGACTGTAT at Chromosome 1 positive strand position 170,666,451 bp (GRCm38) and ending after TCAGGGATTTCATCCTTAGTGCAG at position 170,666,840 bp in intron 6. This mutation deletes exon 5 and is predicted to cause amino acid sequence changes after residue 241 and early truncation 13 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Olfml2b<em1J>,
  • Olfml2b<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories