| Primary Identifier | MGI:5644714 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rab11fip4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Rab11fip4-6842J-M9341 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CGTCTACAAGTGCGTCTGCA, ATGACATTGGCCCTACCTGA and ACGGGTACTTTCTAGCTCCG, which resulted in a 405bp deletion beginning in intron 4 at CGTGACTCAGCCACCATGAGAG at Chromosome 11 positive strand position 79,680,652 bp (GRCm38) and ending after TTTCTAGCTCCGGGGCCACATGCC at position 79,681,056 bp in intron 5. This mutation deletes exon 4 and is predicted to cause amino acid sequence changes after residue 112 and early truncation 28 amino acids later. |
