|  Help  |  About  |  Contact Us

Allele : Pbsn<em1(IMPC)J> probasin; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5662440 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Pbsn
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Pbsn-6978J-F3145 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: TTAAGGTCGTGCATTCATTC,ACATTGGAATGTAGATATCA,TCGTATTGTATATTACTCCA, and TTTATGTGGAATCAGGACCC, which resulted in a 212 bp deletion in intron 3 beginning at Chromosome X negative strand position 77,845,123 bp, CCCTGGAGTAATATACAATACG, and ending after TGATATCTACATTCCAATGTAA at 77,844,912 bp (GRCm38/mm10) in intron 4. This mutation deletes exon 3 and is predicted to cause early truncation after 72 amino acids.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Pbsn<em1J>,
  • Pbsn<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories