| Primary Identifier | MGI:5662440 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pbsn |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Pbsn-6978J-F3145 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: TTAAGGTCGTGCATTCATTC,ACATTGGAATGTAGATATCA,TCGTATTGTATATTACTCCA, and TTTATGTGGAATCAGGACCC, which resulted in a 212 bp deletion in intron 3 beginning at Chromosome X negative strand position 77,845,123 bp, CCCTGGAGTAATATACAATACG, and ending after TGATATCTACATTCCAATGTAA at 77,844,912 bp (GRCm38/mm10) in intron 4. This mutation deletes exon 3 and is predicted to cause early truncation after 72 amino acids. |
