|  Help  |  About  |  Contact Us

Allele : Serpina1f<em1(IMPC)J> serine (or cysteine) peptidase inhibitor, clade A, member 1F; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5649012 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Serpina1f
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Serpina1f-6844-M9369 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CTGGGTAGTTCCTGGGACTG, TGGATCGGGTATGATGAAGT and AGGAGCCCGGAGCCTCCTCT which resulted in a 117 bp deletion beginning in exon 3, CGATCCAGGGAAGATGCAGAAGG, at Chromosome 12 negative strand position 103,691,823 bp and ending after AACTACCCAGAGGCATCC at position 103,691,707 bp (GRCm38) in intron 4. This mutation causes a deletion of exon 3 after 28bp and removes the splice donor from the end of the exon, which may allow for read through in the intron in which case this mutation would be predicted to result in an amino acid change after residue 219 and truncation 39 residues later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Serpina1f<em1J>,
  • Serpina1f<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories