| Primary Identifier | MGI:5649013 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Spink12 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Spink12-6847-M9341 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CATTGTGGTTAGCTGCAACT, AGGAGGCTTTCAGGTATGTA and CCCCAGTGCTTAAGTTGGAA, which resulted in a 109 bp deletion beginning in intron 2 at Chromosome 18 negative strand position 44,106,529 bp starting at CCTTGGCTCACAGCATCTACAGTGA and ending after ATGGGGTTCTGCTGCGTCTGT at position 44,106,421 bp in exon 3 (GRCm38). This mutation results in a 93bp deletion in intron 2 and 16bp deletion in exon 2 removing the splice donor, which is predicted to prevent splicing to exon 2 and to result in amino acid changes after residue 38 and early truncation 6 residues later. |
