|  Help  |  About  |  Contact Us

Allele : Spink12<em1(IMPC)J> serine peptidase inhibitor, Kazal type 12; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5649013 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Spink12
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Spink12-6847-M9341 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CATTGTGGTTAGCTGCAACT, AGGAGGCTTTCAGGTATGTA and CCCCAGTGCTTAAGTTGGAA, which resulted in a 109 bp deletion beginning in intron 2 at Chromosome 18 negative strand position 44,106,529 bp starting at CCTTGGCTCACAGCATCTACAGTGA and ending after ATGGGGTTCTGCTGCGTCTGT at position 44,106,421 bp in exon 3 (GRCm38). This mutation results in a 93bp deletion in intron 2 and 16bp deletion in exon 2 removing the splice donor, which is predicted to prevent splicing to exon 2 and to result in amino acid changes after residue 38 and early truncation 6 residues later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Spink12<em1J>,
  • Spink12<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele