| Primary Identifier | MGI:5649014 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Wdr17 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Wdr17-6900-M282 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, TTAGTTAATCACACCTTCGA, CGTTCCAAATGATCACTAAG and AACAGTTGAGTTCTTCTTTT, which resulted in a 159 bp deletion beginning in intron 4 at Chromosome 8 negative strand position 54,693,261 bp starting at GTTGGGCATGCTTTGTTTTAG and ending after TAACTTAGTGATCATTTGG at position 54,693,103 bp in exon 4 (GRCm38). This mutation removes 21 bp from intron 4 and 138bp from exon 4 essentially deleting exon 4 from the transcript, and is predicted to cause an amino acid change after residue 65 and early truncation 141 amino acids later. |
