|  Help  |  About  |  Contact Us

Allele : Wdr17<em1(IMPC)J> WD repeat domain 17; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5649014 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Wdr17
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Wdr17-6900-M282 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, TTAGTTAATCACACCTTCGA, CGTTCCAAATGATCACTAAG and AACAGTTGAGTTCTTCTTTT, which resulted in a 159 bp deletion beginning in intron 4 at Chromosome 8 negative strand position 54,693,261 bp starting at GTTGGGCATGCTTTGTTTTAG and ending after TAACTTAGTGATCATTTGG at position 54,693,103 bp in exon 4 (GRCm38). This mutation removes 21 bp from intron 4 and 138bp from exon 4 essentially deleting exon 4 from the transcript, and is predicted to cause an amino acid change after residue 65 and early truncation 141 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Wdr17<em1J>,
  • Wdr17<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele