|  Help  |  About  |  Contact Us

Allele : Abca9<em1(IMPC)J> ATP-binding cassette, sub-family A member 9; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5649019 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Abca9
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Abca9-6893J-M2445 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, ACAATCTCATCAGTCAACTC, CATTATCTCATGGGTGGCTT and CTTTTAAGTACTTGACTCTA, which resulted in a 467 bp deletion beginning in intron 3 at Chromosome 11 negative strand position 110,163,505 bp, at TTAAAAGTGGAGAAACTTAAATGG, and ending after CTGATGAGATTGTTGGAC at position 110,163,039 bp in intron 4 (GRCm38). This mutation deletes exon 3 and is predicted to cause amino acid sequence changes after residue 33 and early truncation 11 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Abca9<em1J>,
  • Abca9<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories