| Primary Identifier | MGI:5649019 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Abca9 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Abca9-6893J-M2445 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, ACAATCTCATCAGTCAACTC, CATTATCTCATGGGTGGCTT and CTTTTAAGTACTTGACTCTA, which resulted in a 467 bp deletion beginning in intron 3 at Chromosome 11 negative strand position 110,163,505 bp, at TTAAAAGTGGAGAAACTTAAATGG, and ending after CTGATGAGATTGTTGGAC at position 110,163,039 bp in intron 4 (GRCm38). This mutation deletes exon 3 and is predicted to cause amino acid sequence changes after residue 33 and early truncation 11 amino acids later. |
