| Primary Identifier | MGI:5662453 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mon1a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Mon1a-6967J-F4413 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: GAGGTAAAAGAAGGACACCA, CTAAGTCAACGACCTGGGGA, CTAGTGACTGAGCAACATGT, GTAGAATAGCCAGGCCTCCA, which resulted in a 355bp deletion beginning in intron 2 at Chromosome 9 positive strand position 107,898,539 bp, GAAGCCATCCCCAGGTCGTTGACTTA, and ending after CTTCCTTTCCTTCCTACATG at 107,898,893 bp (GRCm38/mm10) in intron 3, which results in the deletion of exon 2, which is the first coding exon, so lacks the translation start site and first 42 amino acids and is predicted to be a null allele. If splicing and translation occurs from the first ATG in exon 3, this would produce a 507 amino acid protein that differs from wildtype by the lack of the first 49 amino acids. |
