|  Help  |  About  |  Contact Us

Allele : Mrpl44<em1(IMPC)J> mitochondrial ribosomal protein L44; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5662419 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Mrpl44
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Mrpl44-6962J-M4324 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: TCTAACAGTCTAAATACAAA, AAGTTAGAGCACACCTTACG, GTTGTACCAAGATCTAGCAA, and ACAGTCTTCATGTGGGCAGA, which resulted in a 604bp deletion beginning in intron 2 at Chromosome 1 positive strand position 79,777,806 bp, CTTACGTGGTACCATGCCCT, and ending after TTTCTCATGCATTCCTTTGC at 79,778,409 bp (GRCm38/mm10) in intron 3. This mutation results in the deletion of exon 2 and is predicted to cause amino acid sequence changes after 60 residues and early truncation 2 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Mrpl44<em1J>,
  • Mrpl44<->,
  • Mrpl44<em1J>,
  • Mrpl44<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

6 Publication categories