| Primary Identifier | MGI:5662419 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mrpl44 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Mrpl44-6962J-M4324 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: TCTAACAGTCTAAATACAAA, AAGTTAGAGCACACCTTACG, GTTGTACCAAGATCTAGCAA, and ACAGTCTTCATGTGGGCAGA, which resulted in a 604bp deletion beginning in intron 2 at Chromosome 1 positive strand position 79,777,806 bp, CTTACGTGGTACCATGCCCT, and ending after TTTCTCATGCATTCCTTTGC at 79,778,409 bp (GRCm38/mm10) in intron 3. This mutation results in the deletion of exon 2 and is predicted to cause amino acid sequence changes after 60 residues and early truncation 2 amino acids later. |
