|  Help  |  About  |  Contact Us

Allele : Mrpl3<em1(IMPC)J> mitochondrial ribosomal protein L3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5662430 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Mrpl3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Mrpl3-6966J-F0101 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: CACTTCTTATAATAACACGG, ACAAACCACACCATTCCCTG, CAAGCCATACTGTAATTAAG, TTATCTGGAAACAAATAAGC, which resulted in a 355 bp deletion beginning in intron 2 at Chromosome 9 positive strand position 105,054,289 bp, CCCCGTGTTATTATAAGAAGTGT, and ending after GATGTGACCCCTTAATTAC at position 105,054,643 bp (GRCm38/mm10) in intron 3. This mutation deletes exon 2 and is predicted to cause amino acid sequence changes after residue 31 and early truncation 45 amino acids later. There is an additional 37 bp deletion in intron 3, downstream of the 355 bp deletion, that is not expected to impact the exon deletion results.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Mrpl3<->,
  • Mrpl3<->,
  • Mrpl3<em1J>,
  • Mrpl3<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

6 Publication categories